Copyright ©2003 by Paul Niquette. All rights reserved. |
|
Copyright ©2003 by Paul Niquette. All rights reserved. |
 he
sophisticated solver of this puzzle
will be
concerned that the use of 'dibits' for coding the four
nucleotides can
make every transmission vulnerable to communications
glitches. With
no framing or redundancy, every possible string of bits
can be interpreted
as an ostensible sequence of nucleotides.
Accordingly, the loss of in the transmission would thereafter allow the first bit of each code to be interpreted as the second bit of that code and the second bit of each code to be interpreted as the first bit of the next code.By postulating such a happenstance near the beginning of the transmission in the Martian Microbe puzzle, the sophisticated solver can readily reproduce the 100-nucleotide sequence that would have been sent without the glitch as... |
||||||
|
CGGGTGCCGACCCTGCGATCGTTAG GATGGCCGATCGCGCGCGGTGGAAC CAGCTCTCCGTCTACGACAACAGGT |
||||||
...and the relative frequencies will
look like this...
Oops. Quite close agreement, it would seem. There may indeed be a peculiar life-form on Mars; however, the Martian Microbe sequence could have resulted from a rather mundane kind of bug -- plus contamination by a pre-launch sneeze back on the planet Earth. |
Home Page Puzzle Page Space Stuff
The Puzzle as a Literary Genre