Martian Microbe

Copyright 2003 by Paul Niquette.  All rights reserved.

When the "Martian Microbe" sequence of nucleotides first arrived from Sojourner Rover II, geneticists on the Pathfinder Mission were astonished.  The statistical distribution was sharply distinguished from DNA strands commonly found on the planet Earth, thus appearing to rule out contamination from terrestrial sources.  Was this not evidence of a life form peculiar to Mars?

The microminiature, fluorescent DNA analyzer aboard SRII automatically sequences samples and encodes them into 'dibits' for relayed transmission to earth as follows: 

  • Guanine.....11
  • Cytosine....10
  • Adenine.....01
  • Thymine....00
Here are the first 100 nucleotides in the sequence that caused all the excitement:
AGAGAGACGAGGATCGTCGCGCAGG
AAGGCAGAACGAATAGACCAACTTG
GCCAGGAACCAAGAGAGAGGGGCCG
AATGGTATAAACATTGACGTCGTGGC

Geneticists noticed the discrepancies right away...
 
 
Nucleotide
Martian Microbe
Earth-Life
Guanine
Cytosine
Adonine
Thymine
36.0%
21.0%
29.0%
14.0%
35.7%
28.6%
21.4%
14.3%

...the relative frequencies of Adonine and Cytosine appear to be reversed in the Martian Microbe from those which are most commonly observed in Earth-Life sequences.

Is there any other explanation?

GO TO SOLUTION PAGE